HIV-1 Sequence Quality Analysis Tool

This tool is designed to use determine the quality of a specific HIV sequence. The sequence is analyzed for contamination using BLAST with both public (GenBank) and personal (unpublished sequences) sequence databases. Sequence translational problems (such as frame shift and stop codons mutations) are identified using complete genome and the proteome of the HIV-1 reference sequence HXB2.



Example Sequences (Copy and Paste the FASTA sequences)

>gi33300549
CCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAATACAAGTAGGGGGACAGCTAAGGGAAGCTCTATTAGATACAGG
AGCAGATGATACAGTATTAGAAGACATAAATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTA
TCAAAGTAAAACAGTATGATAACATATGCATAGACATTTGTGGACACAAGGCTATAGGTACAGTGTTGGTAGGACCTACA
CCTGCCAACATAATTGGAAGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCGATTAGTCCTATTGAAACTGT
ACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAA
CAGAAATATGTACAGAAATGGAAAAAGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATATAATACTCCAGTATTT
GCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGATTTTTG
GGAGGTCCAATTAGGAATACCGCATCCTGCAGGGTTAAAAAAGAAAAAGTCAGTAACAGTACTGGATGTGGGGGATGCAT
ATTTTTCAGTTCCCTTAGATAAGGACTTCAGGAAGTACACTGCATTCACCATACCTAGTCTCAACAATGAGACACCAGGA
ATTAGGTACCAGTACAATGTGCTTCCACAAGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATCTT
AGATCCTTTTAGAGCAAAAAATCCAGACATAGTTATCTACCAATACGTGGATGATTTGTATGTAGGGTCTGACTTAGAAA
TAGGGCAGCATAGAACAAAAATAGAGGAGTTAAGAGAACATCTACTGAAATGGGGATTTTTTACACCAGACAAAAAACAT
CAAAAGGAGCCCCCATTCCTTTGGATGGGGTATGAACTCCATCCTGATAAATGGGCAGTGCAG
>CRF02_AG.FR.DJ263
AAATTGGGCCTGAAAATCCATACAATACTCCAGTGTTTGGCATAAAGAAGAGAGATAGTACTAAATGGAGAAAATTAGTA
GATTTCAGAGAACTCAATAAGAGAACTCAAGACTCCTGGGAGGTCCAATTAGGAATACCTCATCCCGCGGGATTAAAAAA
GAAAAAATCAGTAACAGTACTAGATGTGGGTGATGCATATTTTTCAGTCCCCTTAGATAAAGACTTTAGAAAGTATACTG
CATTCACTATACCTAGTACAAATAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGA
TCACCAGCAATATTTCAGGCAAGCATGACAAACATCTTAGAGCACTATAGAATAAAAAATCCAGAGATAATGATCTACCA
ATATATGGATGATTTATATGTAGGATCTGACTTAGAGATAGAGCAGCATAGAGCAAAAATAGAGGAGTTGAGAGAACATC
TACTAAAATGGGGATTTACCACACCAGATAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCAT
CCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAAAAAGACAGCTGGACTGTCAATGATATACAGAAATTAGTGGG
AAAACTAAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTAAAGCAACTGTGTAAACTCCTCAGGGGAGCCAAAGCAT
TAACAGATATAGTACCACTGACTGAGGAAGCAGAATTAGAATTGGCAGAGAACAGGGAAATTCTAAAAGAACCTGTACAT
GGAGTATATTATGACCCAGCAAAAGACCTAATAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTA
TCAAGAGCCATTTAAAAATCTAAAAACAGGAAAATATGCAAAAAGGAGGTCTGCCCACACTAATGATGTAAAACAATTAG
CAGAGGTAGTGCAAAAAGTGGTTACAGAAAGCATAGTAATATGGGGAAAGACCCCTAAATTTAGACTACCCATACAAAGA
GAAACATGGGAAGCATGGTGGATGGAGTATTGGCAGGCTACCTGGATTCCTGACTGGGAGTTCGTCAATACCCCTCCTCT
AGTAAAATTGTGGTACCAGTTAGAGAAAGACCCCATAGTAGGAGCAGAAACCTTCTATGTAGATGGGGCAGCTAATAGGG
AGACTAAGCTAGGAAAAGCGGGGTATGTCACTGACAGAGGAAGACAAAGGTTGTTTCCCTAACTGAGACAACAAATCAAA
AGACTGAGTTACATGCAATTTATCTAGCCTTGCAGGACTCAGGATCAGAAGTAAATATAGTAACAGACTCACAGTATGCA
TTAGGAATCATTCAGGCACAACCAGACAGGAGTGAATCAGAGTTAGTCAATCAAATAATAGAGAAGCTAATAGAAAAGGA
CAAAGTCTACCTGTCATGGGTACCAGCACACAAAGGGATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTAATGGAA
TCAGGAAGGTACTATTTTTAGATGGCATAGATAAAGCCCAAGAAGAGCATGGAAGATATCACAGCAATTGGAGAGCAATG
GCTAGTGATTTTAATCTGCCACCTATAATAGCAAAAGAAATAGTGGCCTGCTGTGATCAATGTCAGCTGAAAGGGGAAGC
CATGCATGGACAAGTAGACTGTGGTCCAGGAATATGGCAATTAGATTGTACACATTTAGAAGGAAAAATTATCCTGGTAG
CAGTCCATGTAGCCAGTGGTTATATAGAAGCAGAAGTTATCCCAGCAGAAACAGGACAGGAGACAGCATACTTTATACTA
AAATTAGCAGGAAGATGGCCAGTGAAAGTAATACACACAGACAATGGCAGCAATTTTACCAGTGCTGCAGTAAAGGCAGC
ATGTTGGTGGGCAAATGTCACACAGGAATTTGGAATTCCCTACAATCCCCAAAGCCAAGGAGTAGTGGAAGCTATGAATA
AAGAATTAAAGAAAATCATAGGGCAGGTCAGGGATCAAGCTGAACACCTTAAGACAGCAGTACAGATGGCAGTATTCATT
CACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAATAGACATAATAGCATCAGATATACA
AACTAAAGAACTACAAAAACAGATTACAAAAATTCAAAATTTTCGGGTCTATTACAGGGACAGCAGAGACCCCATTTGGA
AAGGACCAGCAAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAGGACAAGAGTGATATAAAGGTAGTACCAAGA
AGAAAAGCAAAAATCATTAAAGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAGGTAGACAGGATGAGGA
>gi333005683 
CCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAATACAAGTAGGGGGACAGCTAAGGGAAGCTCTATTAGATACAGG
AGCAGATGATACAGTATTAGAAGACATAAATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTA
TCAAAGTAAAACAGTATGATAACATATGCATAGACATTTGTGGACACAAGGCTATAGGTACAGTGTTGGTAGGACCTACA
CCTGCCAACATAATTGGAAGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCGATTAGTCCTATTGAAACTGT
ACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAA
CAGAAATATGTACAGAAATGGARAAAGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTT
GCCATAAAGAAAAAAGAAAGTTCTAGTTCTAAATGGAGAAAGGTAGTAGATTTCAGAGAACTTAATAAAAGAACTCAAGA
CTTCTGTGAAGTCCAATTAGGAATACCACATCCTGCAGGATTAAAAAAGAACAAATCAGTAACARTACTRGATGTGGGTG
ATGCATATTTTTCAATTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGAAA
CCAGGGATTAGATATCAGTACAATGTGCTYCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAA
AATCTTAGAGCCTTATAGAAAACAAAATCCAGACATAGTTATCTGTCAATACATGGATGATTTGTATGTAGCATCTGACT
TAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATTTGTGGAAGTGGGGATTCTACACACCAGACAAA
AAATATCAGAAAGAACCCCCATTCCTTTGGATGATTCCTTTGGATG
>gi|20136660|gb|AF493411.1
CCTCAGATCACTCTTTGGCAGCGACCCTTCGTTACAATAAAAATAGGGGGACAACTAATAGAAGCCCTATTAGATACAGG
AGCAGATGATACAGTATTAGAAGACATAGATTTGCCAGGAAGATGGAAACCAAAAATAATAGGAGGAGTTGGAGGTTTTA
TCAAAGTAAGACAGTATGATCAGGTACCTGTAGAAATCTGCGGACATAAAGTTATAACTACAGTATTAGTAGGAGCTACA
CCTGTCAACATAATTGGAAGAAATCTGATGACTAAGATTGGCTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGT
ACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTCAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAA
TAGAAATTTGTACAGAATTGGARAAAGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTT
GCCATAAAGAAAAAAGAAAGTTCTAGTTCTAAATGGAGAAAGGTAGTAGATTTCAGAGAACTTAATAAAAGAACTCAAGA
CTTCTGTGAAGTCCAATTAGGAATACCACATCCTGCAGGATTAAAAAAGAACAAATCAGTAACARTACTRGATGTGGGTG
ATGCATATTTTTCAATTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGAAA
CCAGGGATTAGATATCAGTACAATGTGCTYCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAA
AATCTTAGAGCCTTATAGAAAACAAAATCCAGACATAGTTATCTGTCAATACATGGATGATTTGTATGTAGCATCTGACT
TAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATTTGTGGAAGTGGGGATTCTACACACCAGACAAA
AAATATCAGAAAGAACCCCCATTCCTTTGGATG
>HMDR4
CCCATTAGTCCTATTGAAACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGAC
AGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAATTGGAAGAGGCAGGAAAAATTTCAAAAATTGGGCCTGAAA
ATCCATACAATACTCCAGTATTTGCCATAAGGAAAAAGAATAGTACTAAATGGAGAAAAATAGTAGATTTCAGAGAACTT
AATAAGAAAACTCAAGACTTTTGGGAAGTTCAATTAGGAATTCCACATCCCGGAGGGTTAAAAAAGAAAAARTCAGTAAC
AGTACTGGATGTGGGTGATGCATATTTTTCAATTCCCTTAGATAAAGACTTCAGGAAGTATACTGCCTTTACCATACCTA
GTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTCCCACAGGGATGGAAAGGATCACCAGCAATATTC
CCAAGCTGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACGTGGATGATTT
GTATGTAGGATCTGACTTAGAAATAGAGCAGCATAGAACAAAAATAGAGGAACTAAGACAATATCTATGGAAATGGGGAT
TTTACACACCAGAGAACAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACA
GTACAGCCTATAGTGCTACCAGAAAAAGA
>AF493411.1
CCTCAGATCACTCTTTGGCAGCGACCCTTCGTTACAATAAAAATAGGGGGACAACTAATAGAAGCCCTATTAGATACAGG
AGCAGATGATACAGTATTAGAAGACATAGATTTGCCAGGAAGATGGAAACCAAAAATAATAGGAGGAGTTGGAGGTTTTA
TCAAAGTAAGACAGTATGATCAGGTACCTGTAGAAATCTGCGGACATAAAGTTATAACTACAGTATTAGTAGGAGCTACA
CCTGTCAACATAATTGGAAGAAATCTGATGACTAAGATTGGCTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGT
ACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTCAAACAATGGCCATTG

Tool Information?

submit sequences
example sequences
tutorial
decision trees

Problems, questions and suggestions please contact:
Tulio de Oliveira or Heikki Lehvaslaiho
, South African National Bioinformatics Institute, University of Western Cape, South Africa.


Page last updated by Tulio de Oliveira.