Bioafrica home pageLaboratory for Clinical and Evolutionary Virology home page

REGA HPV Example Sequences


>gia5_HPV82
GTGTATTTACCACCTGCA---CCAGTGTCACGCATTGTCAACACAGAAGAATATATAACC
CGCACCGGCATATATTATTATGCAGGCAGTTCCAGACTTATTACCTTAGGACATCCATAT
ATACCTAAGGTATCTGCCTTTCAGTATAGGGTGTTTAGGGTACAGTTACCTGACCCCAAC
AAATTTGGTCTTCCTGATCCTAATTTGTTTAATCCAGACACAGATCGTTTGGTGTGGGGA
TGTGTTGGTGTTGAAGTAGGTAGGGGTCAGCCGTTAGGTGTTGGCCTTAGTGGTCATCCT
TTATTTAATAAGTATGATGATACTGAAAACGATGTTAGGGACAACATATCTGTGGACAAC
AAACAAACTCAGTTATGCATTATAGGCTGCGCTCCTCCTATTGGGGAACACTGGGGTGAC
TGTCCACCTTTGGAACTTGTGTCTACTGTCATTGAGGATGGCGATATGGTGGACACTGGT
TTTGGGGCCATGGATTTTGCTAATTTACAAGCTACTAAATCAGATGTTCCATTGGATATT
GCTCAGTCTGTGTGTAAATACCCTGATTACTTAAAAATGTCAGCAGATACATATGGCAAT
TCTATGTTTTTTCATTTACGCAGGGAGCAAATATTTGCTAGGCATACTCCCAGTGGTTCT
ATGATAACCTCTGATTCTCAGATTTTTAATAAGCCTTATTGGTTGCATCGCGCCCAGGGC
CACAATAATGGCATTTGCTGGAATAATCAGCTTTTTATTACTTGTGTTGACACTACTAAA
AGTACCAATTTAACCATTTTTAAGCAGTACATTAGGCATGGGGAAGAATATGAATTGCAA
TTTATATTTCAATTGTGTAAAATCACTTTAACTACTGAAATTATGGCTTACCTGCACACC
ATGGATTCTACAATTTTAGAACAGTGGAATTTTGGATTAACACCCCCCTCCGCTAGTTTG
GAGGATGCCTATCGATTTGTACCTTTGGCAAAATATAAATTTTGGAATGTAGACCTTAAG
GAACGCTTTTCTTTGGATTTGGATCAGTTTGCATTGGGTCGCAAGTTTTTA
>gia6_HPV53
GTTTATCTGCCTCCTACC---CCTGTATCAAAGGTCATTACAACGGATGCCTATGTAAAA
CGCACCACTATATTTTATCATGCTGGAAGCTCTCGCTTGCTTACCGTGGGACATCCTTAT
ATCCCTAAGGTGTCTGCATTTCAGTATAGGGTGTTTAGAGTACGCCTCCCAGATCCTAAT
AAGTTTGGCCTTCCTGATACAAATATATTTAATCCTGACCAGGAGCGGCTTGTATGGGCC
TGTGTAGGGCTAGAGATTGGCCGTGGACAGCCTTTAGGTGTTGGTGTAAGTGGCCATCCA
CTGTTCAATAGGTTGGATGACACTGAAAGCGACAGTAGGGATAATGTTTCAGTGGATCCT
AAACAAACACAGTTATGCATTATTGGCTGTGCACCCGCTATAGGTGAACACTGGGGCGAC
TGCCCCCCATTGGAACTTATCAATTCACCTATTGAGGATGGAGACATGGTGGACACAGGT
TTTGGTGCATTAAACTTTAAAGCTTTGCAGGAATCTAAATCTGATGTGCCATTGGATATT
GTACAATCCACATGTAAATATCCCGATTATTTGAAAATGAGTGCAGATGCCTATGGGGAT
TCTATGTGGTTTTATTTACGTAGGGAACAGTTGTTTACCAGACATACACCTAGTGGGTCT
ATGATAACTTCAGAGGCTCAATTGTTTAATAAGCCATATTGGCTGCAACGTGCCCAGGGA
CATAATAATGGCATCTGTTGGAACAATCAGTTATTTGTAACTGTTGTGGATACCACCAGG
AATACAAACATGACTCTTATTAAACAGTATGTTAGACATGCAGAGGAATATGAATTACAA
TTTGTGTTTCAACTATGTAAAATATCCCTGTCTGCTGAGGTTATGGCCTATTTACATACT
ATGAATTCTACCTTACTGGAAGACTGGAATATAGGTTTGTCGCCTGTTGCCACTAGCTTA
GAGGACAAATACAGATATGTGCCACTATCTAAATATAAATTTTGGGAGGTCAATTTGCAA
AACAGTTTTTCTGCTGATTTGGATCAGTTTCCTCTTGGCAGGAAGTTTTTA
>gi|45184601|gb|AY546078.1| Human papillomavirus isolate FA140.2 major capsid protein L1 gene, partial cds
ATGATGTAAGATCAACAGATGGATTAAGAATAGAAGTCCCTAAAGTTTCTGGAAATCAGTATAGAGCCTT
TAGAGTCACATTACCAGATCCTAATAAGTTTGCCTTGGCAGATATGTCAGTTTACAATCCAGAAAAGGAA
AGATTAGTTTGGGCATGTGCAGGCCTTGAGATAGGACGAGGGCAGCCATTAGGTGTAGGTACTACAGGAC
ATCCTTTATTTAATAAGTTAAGAGACACTGAAAATAATAGCAGCTATCAAGGTGGATCTACTGATGATAG
ACAAAACACTTCATTTGACCCTAAACAAGTGCAGATGTTTGTTATAGGCTGTGTACCTTGTATTGGAGAA
CATTGGGACAGGGCTCCTGTATGTGAAAATGAACAAAACAATCAAACAGGCCTGTGTCCACCATTGGAAT
TAAAAAACACTGTTATTGAA
>gi|40232538|gb|AY484508.1| Human papillomavirus isolate FA123.2 major capsid protein (L1) gene, partial cds

TTGATGTTAGATCACCGGATGGTAGTAAAATAGATGTACCAAAGGTTTCAGGGAATCAATTCAGGGCATT
TAGAGTAACATTTCCAGACCCTAATAAGTTTGCATTAGCAGACATGACTATCTATGATCCTGATAAATAC
AGGTTAGTGTGGGCCTGCGCAGGACTTGAAATTGGCCGCGGCCAACCTTTAGGGGTCGGCAGTACAGGAC
ACCCGCTATTTAATAAGCTCCGTGATGCAGAAAATTCTAGTGAACGTCAGGAAGGCACTGTAGATGACAG
AAGAAATATTTCATTTGATCCTAAGCAAGTACAGATGTTTATAATTGGCTGCACACCTTGCTTAGGTGAA
TATTGGGATACAGCTCCTGTCTGTAAAGATGCAGGTAGCCAACTAGGGTTGTGTCCACCTTTAGAATTAA
AAAACAGCGTAATAGAA


Submit sequences
How to cite
HPV Tutorials
HPV Decision Trees
HPV Subtyping Process
HPV Example Sequences
Contact us

Developed by: Annabel Rector, Marc Van Ranst, Andrew Rambaut, and Tulio de Oliveira.

Developed in collaboration between the Africa Centre for Health and Population Studies bioinformatics group, UKZN, South Africa and the the REGA Institute at the Katholieke Universiteit Leuven, Belgium.

Funded by the Marie Curie Fellowship, Flemish Fund for Scientific Research (Fonds voor Wetenschappelijk Onderzoek, FWO) grant G.0513.06 and by a postdoctoral fellowship of the Research Fund K.U.Leuven


Suggestions or problems on the program please contact:  Dr Tulio de Oliveira.